• Class 1 integrons among Klebsiella pneumoniae isolated from urine samples of patients with urinary tract infections in Alborz province
  • Leila Jabalameli,1,* Mahyar Rahmatpanah,2 Hossein Gomar,3 Mohammad Shokrgozar ashkar meidani,4 Javad Jamali Pabandi,5
    1. Department of Microbiology, Faculty of Sciences, Karaj Branch, Islamic Azad University, Karaj, Iran.
    2. Department of Microbiology, Faculty of Sciences, Karaj Branch, Islamic Azad University, Karaj, Iran.
    3. Department of Microbiology, Faculty of Sciences, Karaj Branch, Islamic Azad University, Karaj, Iran.
    4. Department of Microbiology, Faculty of Sciences, Karaj Branch, Islamic Azad University, Karaj, Iran.
    5. Department of Microbiology, Faculty of Sciences, Karaj Branch, Islamic Azad University, Karaj, Iran.


  • Introduction: Klebsiella pneumoniae (K. pneumoniae) is a Gram-negative opportunistic bacterium involved in community-acquired and nosocomial infections. Several infections such as pneumonia, liver abscess, meningitis, bloodstream infections, and urinary tract infections (UTIs) are caused by this bacterium, though it is found in normal flora of the mouth, skin and intestine. Different mechanisms and factors involved in the development and spread of antibiotic resistance. Among them acquisition of resistance genes especially via mobile genetic elements such as integrons is considered as the main factor in the wide distribution of antimicrobial resistance. In the present study, isolation of K. pneumoniae from urine samples and evaluating the presence of class 1 integrons among isolates were investigated.
  • Methods: The obtained isolated bacteria were confirmed as K. pneumoniae via inoculating in to MacConkey agar plates, gram staining, and biochemical tests such as oxidase, urease, SIM, TSI, OF, MR, and VP tests. DNA was extracted by boiling method and in order to amplify class 1 integrons, specific primers with the following sequences were used in PCR technique; hep58, 5’ TCATGGCTTGTTATGACTGT 3’ and hep59, 5’ GTAGGGCTTATTATGCACGC 3’.
  • Results: 80 K. pneumoniae were isolated from the urine samples of attendees with UTI. 35 (43.75%) isolates were obtained from males and the rest of the samples were isolated from females. No significant difference was observed in different age ranges of attendees. 29 isolates were positive in terms of class 1 integrons. PCR amplification of these genes showed five diverse bands of 2.1, 1.9, 1.1, 0.85, and 0.5 kb.
  • Conclusion: Knowing about the increase in Klebsiella pneumoniae isolates harboring class 1 integrons, involved in dissemination of resistant isolates among population, may help physicians control the spread of infections and also choose the more effective therapies.
  • Keywords: Klebsiella pneumoniae, urinary tract infections, class 1 integrons, PCR