• Assay the expression of recombinant human PD-1 mRNA in transfected cancer cells
  • Samane Mohammadzadeh,1,* Mohammad Hassan Emami,2 Fatemeh Maghool,3 Safoora Mohammadzadeh,4
    1. Poursina Hakim Digestive Diseases Research Center, Isfahan University of medical sciences, Isfahan, Iran
    3. Poursina Hakim Digestive Diseases Research Center, Isfahan University of medical sciences, Isfahan, Iran
    4. Poursina Hakim Digestive Diseases Research Center, Isfahan University of medical sciences, Isfahan, Iran


  • Introduction: Programmed cell death protein-1 (PD-1)/PD-L1 pathway is one of the immune checkpoint pathways involved in the regulation of the immune responses and the suppression of anti-tumor defense. Soluble PD-1 improves immune responses and increase mortality of tumor cells as well; the aim of this study was to produce the soluble recombinant human PD-1 construct and also assess the expression of recombinant PD-1 mRNA in the transfected cells.
  • Methods: We designed and produced soluble recombinant human PD-1-GFP-pcDNA3.1/hygro construct. This construct could be expressed in the hypoxia condition due to its VEGFa promoter. We transfected this construct into the MDA-MB-231 cells. After that, we lysed the transfected cells and extracted shPD-1 mRNA. cDNA was synthesized by use of Oligo dt and random hexamers primers. Quantitative real time PCR was performed for determination of the amount of recombinant human PD-1 by the fallowing primers; 5’AGCCACAACGTCTATATCATG3’ as the forward primer and 5’AGGTAGTGGTTGTCGGGC3’ as the revers primer.
  • Results: Real time PCR results showed the lower CT value for transfected cells, which indicate the high expression of recombinant human PD-1 mRNA in the transfected cells and no in the non-transfected cells.
  • Conclusion: shPD-1 gene expression in mRNA showed the susceptibility of PD-1-GFP-pcDNA3.1/hygro construct for expression in cancer cell lines. Therefore, this construct might be used for cancer research (such as some colorectal cancers) with high expression of PD-1-PDL1/2.
  • Keywords: Recombinant, PD-1, mRNA, Transfected, Cancer cell