مقالات پذیرفته شده در هفتمین کنگره بین المللی زیست پزشکی
Designing CRISPR to eliminate miR-200c expression in pancreatic beta cells
Designing CRISPR to eliminate miR-200c expression in pancreatic beta cells
Fatemeh sadat Hosseini Dehaj,1,*Narges Nikoonahad Lotfabadi,2Fatemeh Sefid,3
1. science and arts university, yazd, iran 2. biology department, sciences faculty, science and arts university, yazd, iran 3. Department of Genetics, Faculty of Medicine, Shahid Sadoughi University of Medical Sciences, Yazd. Iran
Introduction: The number of people with diabetes between 20 and 79 years of age is expected to reach 642 million by 2040.
This is of great concern because the increasing prevalence of diabetes increases the number of chronic and acute diseases in the general population, with profound effects on quality of life, demand for health services, and economic costs.
Complications of diabetes, including diseases such as stroke and cardiovascular diseases, such as kidney disease, retinopathy, and neuropathy, are associated with lower limb amputations, and even in diseases such as cancer, aging-related outcomes (e.g., dementia), infections and liver diseases are known to be effective.
This is while now 5% of the deaths occurred due to diabetes, which can be said to increase by 50% in the next ten years. Iran also has nearly 6.3 million people with diabetes and about 7.7 million people with glucose tolerance disorders.
The most common types of diabetes are type I diabetes and type II diabetes, and the distinctive feature of these two is the death of pancreatic beta cells. Type I diabetes occurs due to auto-immunity and the result is the death of β cells, so the amount of insulin hormone decreases drastically. In type II diabetes this decrease is approximately 50% and the severity is less than type I diabetes.
According to the research of Frederick and his colleagues in 2015, removing the expression of mir-200c partially prevents the apoptosis of beta cells.
Controlling type I diabetes requires daily and frequent use of the hormone insulin, but type 2 diabetes can be controlled by taking a series of oral drugs effective on beta cells.
With all this, diabetes doesn't get the desired result with these treatment methods and people with diabetes have to bear the side effects of these in treatment methods in addition to taking medicine or insulin constantly.
Oral medications for diabetes and insulin have many side effects.
The inability of such treatments and the reduction of the effect of these drugs in the long term have caused scientists to discover new and more appropriate ways to control diabetes and its complications.
Compared to previous genome editing tools, namely ZFNs and TALENs, which used difficult-to-engineer proteins to target and cut genomic loci, CRISPR is more time- and cost-effective.
Therefore, it is hoped that through CRISPR we will be able to achieve a favorable treatment for diabetes.
Methods: In this project, using CRISPOR web software for Mir-200c, I designed a gRNA with NHEJ strategy to knock out Mir-200c and considering NGG as PAM, and meanwhile, I tried to find the best option. With the aim of not having off target and high On target efficiency and making the necessary changes in it. Then I chose the lentiCRISPRv2 (Zhang lab) vector for cloning through the CRISPOR site and the vectors it introduces for gRNA, and then I cloned the gRNA using SnapGen software.
Results: The micro RNA sequence we got from the NCBI site:
CCCTCGTCTTACCCAGCAGTGTTTGGGTGCGGTTGGGAGTCTCTAATACTGCCGGGTAATGATGGAGG
Designed gRNA:
AAACACTGCTGGGTAAGACGAGG
Final designed gRNA:
GAAACACTGCTGGGTAAGACG + AGG
Conclusion: In 2016, Chang and his colleagues aimed to investigate the capability of the CRISPR cas9 system in suppressing the expression of microRNAs, through the website https://zlab.bio/guide-design-resources, two numbers of gRNA for each of Mir-200c, Mir17 and Mir141 and with They designed PAM, NGG and also requested the lenti-CRISPR plasmid from Dr. Zhang's laboratory through the Addgene site and as a result of their activity, they observed a 96% decrease in the expression of each of those MicroRNAs. Their gRNA sequences for mir200c, mir17 and mir141 are respectively:
1) 5′-ATACTGCCGGGTAATGATGG-3′ و 2) 5′-CTAATACTGCCGGGTAATGA-3′
1) 5′-TGTCAAAGTGCTTACAGTGC-3′ و 2) 5′-TGAAGGCACTTGTAGCATTA-3′
1) 5′-TCCATCTTCCAGTACAGTGT-3′ و 2) 5′-CTAACACTGTCTGGTAAAGA-3′
They also proved that traditional methods such as antisense inhibitors etc. are not very potential for suppressing the expression of members of a family of miRs due to their conserved sequences.
While using the CRISPR system and designing efficient gRNAs, the amount of off-target can be minimized when inhibiting a miR from members of the same family. Another result of their research was that the knock-out effects of CRISPR/CAS9 system on miRs can be stable and long-term.
The work done by Chang and his colleagues also proves our work in the following aspects:
Mr. Chang and his colleagues started working with CRISPR and designing gRNA with the aim of reducing the expression of mRNAs, which happened to include mir-200c, just like what we did, that is, to remove mir-200c, we used the CRISPR system and gRNA In addition, our work, and their work were also similar in other aspects, such as the selected website for gRNA design (CRISPOR is among the sites introduced in Dr. Zhang's laboratory), the selection of NGG as PAM, with the difference that the target Ours were different from each other (our goal is to eliminate the expression of mir-200c for the treatment of diabetes in humans, but their goal was only to investigate the effect of CRISPR in reducing the expression of microRNAs) and for this reason, the designed gRNAs are also different because for us, It was important to have high on-target efficiency and low off-target efficiency, and finally, since they have received a 96% response in reducing the expression of miRs under test, then probably our project will also be successful, and all this is a proof of correctness our method and purpose.
So far, no research has been done to treat diabetes through CRISPR technology. According to the research of Frederick and his colleagues, the lack of mir-200c prevents the apoptosis of beta cells to some extent, so by knocking out mir-200c, we will reach the same result as they did.